Transpositioning, a Hypertext Ethnography

• Instructions
• Index
• Directory
• Start R
• Start R, Again
• Hello, R!
• If False
• Email, First
• Objects [Under Study]
• Breakdown
• Decay
• Surface
• Spool
• Transposons
• RNA-seq
• Processing At a Later Time
• Work from Home
• Shut Down
• Diagram
• Galaxy
• FASTQ
• Toshi Teaches Suga-San
• Reference Genome
• First Day in The Lab
• Toshi Describes Coding
• Parents and Children
• Watching Toshi Code
• How Toshi Learned to Code
• Neighbors
• Vocabulary
• Transpositioning
• Toshi Teaches Mitsuyo
• Trouble with Galaxy
• Zoom
• Trouble with Galaxy, Again
• Email, All
• Acknowledgements & References

First, make a working directory.

First, make a working directory.

$ mkdir start $ cd

Then, start R:

$ R

As a convention, we will start learning R programming by writing a "Hello, World!"

First, make a working directory.

$ mkdir start $ cd

Then, start R:

$ R

As a convention, we will start learning R programming by writing a "Hello, World!"

R Tutorial

Taken from Tutorials Point: R - Basic Syntax:

This will launch R interpreter and you will get a prompt > where you can start typing your program as follows −

> myString <- "Hello, World!" > print ( myString) [1] "Hello, World!"

Here first statement defines a string variable myString, where we assign a string "Hello, World!" and then next statement print() is being used to print the value stored in variable myString.

>Comments are like helping text in your R program and they are ignored by the interpreter while executing your actual program. Single comment is written using # in the beginning of the statement as follows −

# My first program in R Programming

R does not support multi-line comments but you can perform a trick which is something as follows −

if (FALSE) { "This is a demo for multi-line comments and it should be put inside either a single OR double quote" } myString <- "Hello, R!" print ( myString) [1] Hello, R!

if(FALSE) { "This is where I say: this isn’t fiction. But it isn’t ‘truth’ either, unless truth is an incomplete, and not altogether true, alternative to not-fiction." } myString <- “1. title of post” print ( myString) 1. What do you do with data that you don’t know what to do with?

From: Rebecca Carlson <email address>
Date: Tuesday, March 24, 2020 18:16
To: Mitsuyo <email address>
Subject: tomorrow morning!

Hi Mitsuyo,

I meant to email earlier to check in with you but the day got away from me! I hope things are going well for you.

Tom has said it is okay for me to call in to participate virtually with your meeting tomorrow morning. If that works okay for you, I thought the easiest thing to do was start a zoom meeting, which is pretty easy to use.

Here's the link to use, if this sounds okay to you.

Thanks and see you tomorrow morning,
Rebecca

https://Zoom Domain.zoom.us/j/Meeting ID

During an R session, objects [under study] are created and stored by name (we discuss this process in the next section). The R command

> objects()

(alternatively, ls()) can be used to display the names of (most of) the objects which are currently stored within R. The collection of objects currently stored is called the workspace.

To remove objects [under study] the function rm is available:

> rm(Toshi, Tom, Mitsuyo, Suga-san, Katie, me)

(From: Venables and Smith, 2022, 6)

Like all technologies and infrastructures, scientific materials and practices are unstable - they become strained, warped and may eventually falter and break down. In his book Signal and Noise (2008), Brian Larkin describes the state of Nigerian media technology such as radios stations and tape players, along with other related utilities like electricity, as existing in a state of breakdown, failure and continual disrepair (61-63). Like any good scientist who goes back to the whiteboard or whatever tool they use to think with, Larkin explains that, “The poor condition of infrastructure and the ubiquity of breakdown bring about their corollary: repair as a cultural mode of existence for technology” (2008, 235). Although Larkin stresses that this dual mode is a “consequence of poverty and innovation” (235), or as Damien Droney describes, a kind of “locally specific improvisation” (which he sees in the canny reuse of plastic bottles by Ghanaian scientists) (2014, 363), breakdowns and their processual “corollary” are particularly productive to think with. Breakdown and repair are both already part of the routine interpretive scientific practice of sorting “signal from noise” - in the transformation of experimental results into meaningful data or even in a metaphorical description of the scientific method itself. Attention to breakdowns and the arduous and even intimate task of fixing, can expose taken for granted ways of doing things, which have been stressed and are under consciously articulated repair. It can bring focus to how individuals creatively operate inside of makeshift, faulty or shifting assemblages within which they themselves are enmeshed.

# if breakdown, print ( unprint)

To the notion of breakdown, Pink et al. add decay, which they take up from Caitlin Desilvey (2006). They write that Desilvey:

…proposes, we should “accept that the artefact is not a discrete entity but a material form bound into continual cycles of articulation and disarticulation” (p. 333), whereby decay can be seen as “generative of a different kind of knowledge” rather than simply a process of erasure (p. 323). [Pink et al. 2018, 2]

For me, decay conjures a previous, and relatively stable, coherence - something which, after being fully formed, can deteriorate or unspool, perhaps organically. But what about trouble, or even rot, at the start? Or for processes in development, practices that take time to get up to speed, or that never quite cohere or work the way they are imagined or intended to from the beginning? Techniques that are warped and resisted in the act of their building up, from their emergence in the “upsteam”? In this way, even a spooling towards “articulation” might be incomplete, causing generative cycles of repair and decay to continually cycle farther and farther away from intentions, or their mark, producing as Desilvey says, “a different kind of knowledge.” But what might that do to bioscientific practices waiting in the “downstream”?

Paul Virilio described new technologies like televisions sets, as windows behind which individuals would become trapped; small boxes which would frame every possible view of the world (Virilio 1997). He saw this as a flattening of (our experience of) reality which he said was growing diminished by speed; landscapes becoming blurred and disappeared as we pass by in train cars (Virilio 1999: 33), supersonic jets (Virilio 2000: 26), and eventually, the internet.

Krasmann (2020) similarly points to a 2D flattening of experience in modern algorithmic technologies, where she sees the “style of reasoning” (citing Hacking, 1982) as a “logic of the surface” (2098). Algorithms may sort and order data and social realities but they do not have “the capacity of ‘reflecting upon’ and ‘understanding’ it” (2098). Karsmann argues as a result, that we confuse algorithmic “results” with “representations of the world” (2099, italics in original). What, she asks, does this do to how we see and know the world?

from Wiktionary, Creative Commons Attribution/Share-Alike License.

noun A device around which thread, wire or cable is wound, especially a cylinder or spindle.

noun (computing) A temporary storage area for electronic mail, etc.

verb To wind on a spool or spools.

verb (computing) To send files to a device or a program (a spooler or a daemon that puts them in a queue for processing at a later time).

Working in the 1940s and 50s and studying the genetics of maize, Barbara McClintock discovered the existence of what are now called transposons, transposable elements, or also “jumping genes”: genes that are able to move places in the genome. She presented the results of her findings to the scientific community at the time but they failed to receive the attention they deserved. McClintok also failed to upend or unsettle common thinking about the rigidity of the genome as it should have. She described her own discoveries as met with “puzzlement, even hostility” (cited in Ravindran 2012).

During an interview with Tom, when I was still visiting the institute in person, he told me that McClintock, “predicted so many things that we are starting to see and accept to be true about genetics today.” Then, he read me a quote from McClintock on her Wikipedia page: “Over the years I have found that it is difficult if not impossible to bring to consciousness of another person the nature of his tacit assumptions when, by some special experiences, I have been made aware of them. One must await the right time for conceptual change” (McClintock, 1973).

R Tutorial - Introduction to RNA-seq

“All RNAs transcribed from genes are called transcripts.

…Differential expression analysis of RNA-seq data can be used to determine if there are significant differences in gene expression between conditions.”

# “Prior to starting the RNA-seq workflow, planning is essential. This step in the analysis is # crucial for good results as there is often no saving a poorly designed experiment.”

Tom and Mitsuyo online meeting, June 3, 2020

[…]

Tom: So the ratio of these two, can you draw out what you think it will look like if you see a change? I don’t know how you are going to interpret these results.

Mitsuyo: So what happens is that, we will have detection of two, for two signals, I am going to, how do you say, enable detection of […] and […] in one reaction I will have a curve for […] and one for […] specifically for […] and in the other tube I am just going to have detection for […] (?) probe that will serve as a control of the reaction and I am going to see, enable a detection of […]

Tom: What are you expecting to see? What is your hypothesis?

# processing at a later time (the things that are left out/over) if(FALSE) { "space intentionally left blank." }

I am in a box, now. A mostly silent, and terrible typist.

And lately, my rhythm is tethered, tied to the words of other people. But my hands are so clumsy and slow. If my attention slips for even one bit, I get lost in the sentence I have stored to the tips of my fingers. Listening to what is quickly becoming past tense. I get disoriented, like grabbing for the pantry handle and opening the silverware drawer instead. The trick is, the only way to get going again, is to give up on something, to settle for crucial information, words lost, meaning unrecoverable.

June 5, 2020

Tom and Mitsuyo online meeting, May 8, 2020

Tom: Alright…sounds like a reasonable game plan for next week. As the work from home has been extended, I think we need a really nicely designed plan for the experiments when you come back, like really well detailed. I am publishing a similar plan for animal experiments. If you find it hard to make a plan, I can share it with you. We will have plenty of work to do but, I prefer if you design a plan that gets us closer to the answer on what you have been working on.

Mitsuyo: Do you think that’s…the cell lines will be ordered? I will expect them to be formalized…how do you say, the ordering process is…

Tom: Yeah, it's kind of shut down until June 7th, but we should have the order ready to go…just waiting on the accounting system. It will probably take about a month for the new cell lines to arrive.

Korona jidai, in the time of corona

In Toshi’s¹ case, the seven week emergency declaration in Tokyo as a result of the “new type coronavirus” (or shingata koronauirusu, as it is called in Japanese) didn’t impact him so much. Toshi had only a few weeks earlier moved from Kobe to begin his time as a postdoc in a genomics research laboratory at a national university institute. He spent a few “normal days” in the lab before the PI began recommending telework for those who could manage, even before the institute officially required it. Toshi continued to go to the lab after the government’s April 7th emergency declaration, which brought “level 4” orders from the institution (stay home, generally), because as a bioinformatic scientist he needed onsite access to the servers of a supercomputer for his data analysis. Wet lab experiments however, those not part of the sanctioned “maintenance of valuable resources,” were largely stopped.

In one of our online interviews—after the institute moved to level 2 but before I was allowed to return (ethnography not considered “essential” work)—Toshi talked to me about the difficulties of doing collaborative science online. Even during level 4, Toshi met regularly with the lab’s PI, Tom, in person to discuss his research progress. Tom needed to come to the lab three days a week to check up on and provide care for the lab’s mice, and they were frequently the only researchers on their floor. Toshi held a page of his notebook up to the camera to show me a diagram he and Tom had sketched out together during one of those meetings, explaining:

In person is better than meeting in Zoom because we can…draw a picture like this…a picture of the concept of human evolution. This is how the human population migrated and diversified around the earth…we will talk about the concept of the ideas and these ideas are really not solid, so we need to draw a picture and think more deeply to clarify what we are thinking. So yeah, in this case…in-person meeting would be really better, definitely better than online.

if(FALSE) { "Excerpt from paper submitted to Medical Anthropology Quarterly on July 17, 2020(status: rejected)." } myString <- “1. admissions/allowances” print ( myString) 1. All names are pseudonyms.

Here’s another kind of map to this story.

# a screenshot of a phylogenetic tree that Toshi created # with Python - # a different kind of lineage.

Galaxy’s tutorial website explains that it, “aims to make computational biology accessible to research scientists that do not have computer programming experience.” (From: Introduction to Galaxy Analyses)

At their weekly one-on-one meeting Mitsyu told Tom his is taking the DNA library he made to Fastq, which Wikipedia defines as:

“FASTQ format is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are each encoded with a single ASCII character for brevity.”

I am using wikipedia to keep up on all the new words I am encountering. My notes are overrun with links and bolded words I mark, vocabulary. The words are like heavy dark questions in my notes, waiting, that don't ever get answered.

totalreads=$(unzip -c <sample>_fastqc.zip <sample>_fastqc/fastqc_data.txt | grep 'Total Sequences' | cut -f 2) echo $totalreads #This number will be used again later so is saved as a variable 'totalreads'

From: A step-by-step analysis pipeline for RNA-seq data from the Cebola Lab

Toshi is back in the pipeline and shows us the directory he is using
he asks Suga-san if she remembers SPC and she says yes
it is easy to use, he is in the terminal
he again is pointing out the directory name,
he transfers the pipeline file to the directory
“mazu, screen te iu harimasu” [first, put it in the screen]
“it takes about 3 minutes to load the pipeline”
we went into screen,
“data is downloading”, he says, “it takes 3 mins, you can eat something”
“when it's over, go back to the terminal”
He types, screen - ls
screen -r 5730
“kono process id to” [to process this id]
“ima download shite, mou download shimashita” [It’s downloading now, it’s already downloaded]
it became a FASTQ file
or FASTQ file hajimemashita

labo no # connect to the lab linux (is eigo ok?, he is writing it in English)
these are instructions for her I realize
#make working dir
he is writing the instructions in text edit

“mkdri”, he types a file name and it fills it in automatically
200602_1
# cd 200602_1
ls # nakami wo kakunin; nanimo nai jyoutai [confirm the contents; in a state of nothing]
one more time, mou ikai, ls, kakunin shio [let’s double check it]
ls and then # japanese and the file name

“screen ni hairimashita”, [I entered it in screen]
“screen” he types

At the end, as Toshi is wrapping up his zoom lesson for her, he says hopefully:

“dekiruso” [seems like you can do it]

If there is anything you don’t understand
“nanika wakateiru nai”

She says: “yoku wakaranai” [I don’t really understand]

June 2, 2020

“GRCh38 'no-alt' assembly from ncbi, Genome Reference Consortium Human Build 38

The DNA sequence is composed of genomic sequence, primarily finished clones that were sequenced as part of the Human Genome Project.”

(From: National Library of Medicine’s GRCh38, or Genome Reference Consortium Human Build 38)

>DNA sequence data stored in a FASTQ file, might look like this:

Skip 1 @HS2000-887_89:5:1101:1595:156011/1 2 ACCTAACCCTAACCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCGTA 3 + 4 @?8BDDDABDHAFEGBGE@?BGE/FHG/GFH@@CG?;BB@B?BGGGHG9FDCF3=2CG;@=?(667?############### 5 @HS2000-887_89:5:1101:1599:35168/1 6 CCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTACCTACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTA 7 + 8 :==<AA3?32a8?+2@A3<7+<ABAABA;@>AAB;0):=A########################################## 9 @HS2000-887_89:5:1101:1624:195842/1 10 CCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTACCTACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTA 11 + 12 CCCFFFFFHGHHHJJJJJJJJJJIJJJJJJJJIJJJJJIJJJJJHJJJIJJJJJIIIFJJHHFFFFFFEEEEDDBCDDDBBD

(From: Reference Genomes and Genomics File Formats, Rockefeller University)

if(false) { "what’s human becoming digits" "collated/collating" }

Where: >“Comments are like helping text in your R program and they are ignored by the interpreter while executing your actual program.” (From: Tutorials Point: R - Basic Syntax)

Beccanator — Today at 10:27 AM
Ok, so in R (maybe others?) you can add notes using #
And those things don't get "processed" right?

Metalhead — Today at 10:28 AM
That's correct. They're called comments

Beccanator — Today at 10:28 AM
But typically, the tutorial says, they have to be one line of text only
Ah, comments, right! Me = total noob
So the tutorial says that you can add multi-line comments like this

Metalhead — Today at 10:28 AM
Everyone's a total noob at one point :)

Beccanator — Today at 10:30 AM
if(FALSE) {
"This is a demo for multi-line comments and it should be put inside either a single OR double quote"
}
Well, my question is about the indentation of the second line…

Metalhead — Today at 10:31 AM
That's not a comment. That is a string that is never evaluated because it's in an if(false) block.

Beccanator — Today at 10:31 AM
Ah, but it works like a comment tho, since it isn't processed
sorry, evaluated

Metalhead — Today at 10:32 AM
I guess it kind of has that effect but I think it's very bad practice. It makes the code difficult to read. Harder to tell what is supposed to be a comment and what is supposed to be code. I think it's much better to just do multiple lines starting with #.

Beccanator — Today at 10:33 AM
Ah hilarious!

Beccanator — Today at 10:35 AM
Ok, but my question is really about the line indentations. I will add somewhere that you think this is bad practice, lol

# An unaligned sequence mapping # To a reference I don’t know

1 @HS2000-887_89

# The machine name

Skip4 @?8BDDDABDHAFEGBGE@?BGE/FHG/GFH@@CG?;BB@B?BGGGHG9FDCF3=2CG;@=?(667?###############

# Following the “+” line, qualities of sequence used in the # “downstream” # And all this I can ignore later in analysis?

My first day in the lab felt like coming into the middle of a conversation and not really knowing what’s going on or what has been said, or what people are really thinking, and either won’t, or haven’t yet had the chance to, tell you.

Watching someone code when I know nothing about programming is just the same.

Toshi is at his cubicle in the lab’s shared office the glass wall to the PI’s space, and a window just behind him. He was screen sharing his coding with me but reached a natural breaking point. It was starting to get dark outside. Sitting back in his chair, his hands away from the keyboard for a moment, he tells me what he’s been working on:

“One job is a bit complicated. I need this script and this part of this script should come from this script. I copy and paste and write script, and all things are in my head. I wrote it down and run it and it is ok and now I can forget it. Scripting is in these rounds: think how to solve problem, how to normalize and write down. Everything during that time I need to focus on writing and constructing algorithms and after I can forget everything and take a break.”

March 22, 2021

So, the analysis file runs the qsub file and then the qsub file runs the batch file, and in the qsub file there is one short simple phrase which I wished I had typed out, but it is basically that phase which commands the batch file to run…all this helps to give me some deeper understanding of how these files are linked together and in this case, it is actually a hierarchical network of commands, parents and children.

In the analysis file, he is adding things; finally, one of the window panes, the bottom one, is processing something and the text reveals itself…in the background.

Again what really strikes me is the intricate network that is happening between all these files and window panes. They are webbed and linked, often directly, by including the file name in the line of code, sometimes just by him copying something and moving it over, and from the internet where he gets his packages that he needs to download and include in the run.

March 22, 2021

He is pasting code into the batch file from up above
It says something like
# load genes
F=/home/….. and the name is the cells_cultured file

Then some code
And then the next segment says
Index = []
And the f= /home file is GETx_public

Back in google to pull up pandas.read_parquet

He is reading the website, it has parameters
Path:
Engine:
Columns, etc.

His batch file code looks pretty
like poetry

The pages looks like this
It is short word
Long file name
Then a series of indented short phrases, with various colors

Sometimes he clicks on the windows just to bring them forward, just as he is thinking in preparation to use them

March 22, 2021

Toshi’s Very Short Oral Presentation:

“This is my personal history as it relates to bioinformatics. When I was an undergraduate student, I briefly touched programming languages. But my skill level did not increase, because I did not have a practical chance to use these languages. Then, when I was a master student, I learned RNA-seq analysis in R. I needed to analyze RNA-seq, so I read a book and asked a nearest bioinformatician how to analyze it. During my Ph.D., my bioinfo-level increased a lot. At this time, my previous boss got awarded a big grant for bioinformatics, so I needed to start using bioinformatics often and deeply. Fortunately, at the same time, a very nice friend of mine with more experience in bioinformatics came to the neighbor lab. So, I was able to learn a lot from him.

As you can see, when it became necessary to analyze some data, then my bioinformatics level increased. When I was an undergrad student, I learned bioinformatics by reading a textbook and executing some sample commands in the book, but this comfortable learning did not cause me to grow. I look back and see that any time my level actually increased, I was facing an “analyze-or-perish” situation.”

To learn to do RNA-seq Katie went to the north building to a lab with a husband and wife team. She brought the wife mac and cheese from Trader Joe’s in the US to make connections; to smooth over the frayed edges of the beginning of any relationship. First she watched the wife do the experiment. She told me it was about more than just the “science,” it was about technique; how to get the protocol right. The husband and wife, they don’t use a kit, or pre-set, of reagents since it’s expensive. Instead they use a home-made one they mix up in the lab. Katie told me that she thought making random kits this way was more complicated than it needs to be, but it’s economical. She had to learn how to make the Tn5, a bacterial transposon. The husband talked her through the scientific rationale, then later came to their lab to teach them how to run the R script which would visualize the data they got. She said R was super user friendly and was taking an EDx class to “make commands and figure out some stuff.” But still she wanted to know why they have to learn to speak a different language.

aliquot, attenuate, chromatin, cytokines, de novo, distribution, divergence, epigenome, exogenous, genotype, libraries, lineages, loci, mutation, mutagens, regulator, recombinant, silencing, transcription, variants

Even words I used to know take on new meanings.

# transpositioning over, a merging you are rearranging (digits) in an abyss writing: possibility acquiring movement for a self, unrecognized over, other variations forgot, that matter of fact not mobility you said, but moving into, transforming relentlessly able

Tom, Mitsuyo and Toshi online meeting, May 21, 2020

Tom: Let’s put these on your directory. This won’t take so long to download right, Toshi?

Toshi: Yeah. Do you have Anaconda? (Mitsuyo: yes) You were using… (Mitsuyo, talking over: But it is not online. I was using from Nishi-san’s computer.) Ah, you should have your own Anaconda, so let’s install.

Toshi: And you can find Anaconda in Google-sensei…

Tom: You can even misspell it and it finds it (laughing)

(Toshi is pulling Anaconda from the internet and searching the results page)

Tom: Can’t you just type in “install Anaconda” or something like that?

Mitsuyo: Sorry, I just…

[a pause]

Tom: What, Mitsuyo?

Mitsuyo: No, no it’s…okay, I thought that the buttons from zoom was…

Toshi: It's usually pretty easy to find the page but… (still looking at search results)

Tom: Why is that not it, Toshi? That looked like it was fine.

Toshi: No, it is not the recent one, eh, doko daro (where is it, I wonder?). I will search on my computer first, maybe they changed the interface.

Mitsuyo: So, ah, each of us will have its own Conda? (Toshi: Yes) So, it is not so heavy right?

Toshi: It’s not so heavy. Maybe you can get one from my, yes… ah, I will use your screen again, Eto, yoisho, [ah, (with effort) go] this one, (he is back in the terminal screen)

Mitsuyo: You transferred from yours? (Toshi: Yes)

Toshi: And now you got a discreet… so let’s run this, Anaconda…

Tom: How do you get it to fill out, what button are you pressing?

Toshi: When I type “tab" it automatically predicts the next words.

Tom: Mitsuyo, make sure you read the license terms, okay? (They laugh)

Tom: (To Toshi) Did you read all of the license (Toshio: No.) You should. (Toshi: I don’t think so.)

Toshi: This will take, ah, two or three minutes. Yes anaconda is really nice platform to… oh, it's finished, so quick! You can see ah, yes, here Anaconda 3, let’s see…yes, Anaconda 3 and this should have been with this directory you have many tools…

[…]

Mituyo: Isn’t there a package for NGS [next generation sequencing]?

Toshi: Yeah, Conda has many packages but some minor packages don’t have Conda so we have to download.

Tom: Bed tools… (he says in a funny voice) Sam tools…you know you can put multiple in at the same time. It’s slow that way cause it has to choose the order of which dependencies to download. (Toshi: Yes)

(Toshi is downloading Anaconda packages…)

Tom: (To Mitsuyo) This is kind of a similar thing to when you’re in the admin mode of Galaxy except the packages for Galaxy are stored in the Galaxy tool shed rather than maintained by Conda.

Toshi: Yes, I downloaded all packages I think, so you can see which comment and Trim Galore [sounds like gallery-a when he says galore]… so… we have this script and we are going to run…

Tom: Mitsuyo, you know…how would you run it…BASH? (Toshi is talking over him)

Toshi: Oh, no sorry, maybe my script is somehow wrong? Yoisho…[(with effort) go]. I was doing this run, so yoisho…(he says it every time he hits the enter key)

Tom: So you are running this, a script, but it would also be possible to run each of these individually.

Toshi: Yes, script is a package of many moments…

Tom and Mitsuyo online meeting May 20, 2020

Mitsuyo: Yeah, another thing that’s so, ah, I was trying different conditions, I’ll change the subject now, I was trying to ah, overcome the Galaxy, Ramada-seq analysis, but I feel like there is I couldn’t like get over the, ah, the tasks are not giving me any results. Like for the STAR analysis, even by changing some different variables, let me find here, (he is navigating)

Tom: That you have got written out…

Mitsuyo: Yeah, you gave me some resources that are pretty good, the bioinformatics workbook, you have the standard pipeline. I think I am struggling mostly formatting, also I will out here like information about the QC [quality control], but you can see here, this is the QC from the pre-trim, but post-trim is also like this (showing pre-trimmed) so post-trim looks that same.

Tom: Makes me suspect that it is not trimming…makes me suspect the first 15 nucleotides are not being trimmed.

Mitsuyo: This is the first position. I thought that the adapters are in the later part of the sequence.

Tom: I am not a hundred percent but this is what I think, that explains why there is such a bias in these 15 residues.

Mitsuyo: I will organize this.

Tom: I don’t think it's necessary to organize, I understand what the point is.

Mitsuyo: Yeah, so maybe the Galaxy is not giving me any…

Tom: Yeah, why don’t we try it on command line with Toshi’s help tomorrow?

Mitsuyo: Yeah okay, so Galaxy like, if I try to manually alter some perimeters, it opens all the options, they are all standard, but I am not sure if they… but I feel like it is mostly these… I guess this is one of the differences from conventional, how do you say, Galaxy, conventional STAR analysis… so I am stuck with this issue but one other thing that I feel like we could defuse the first week when I get back to work…

Tom says he has to step away from his computer for a minute but leaves his camera on. I can see the ceiling of his living room and a large green potted plant. Voices in the background. Mitsuyo says, “Hello, Becca” and I turn my mic on. We chat within the opportunity of Tom’s departure, me as a sudden temporary participant. At one point Mitsuyo tells me, worrying, referring to my absence from the lab, “You only hear about all the problems I’m having.”

if(FALSE) { "But I didn’t write this moment down. And I don’t remember whether he told me on Zoom at a time just like this, or in an email that I can’t find now, and whether Tom and Mitsuyo were really still both at home, or back in the lab already but connecting in online meetings from different rooms at the institute; or what it was exactly that prompted him to say it" }

Tom and Mitsuyo online meeting, May 20, 2020

Mitsuyo: Ah, so I tried with this, I want to show you some things that I did here. I’m not sure why it didn't run. The Galaxy file…I was just checking what things were…so from all the commands that you showed me, those in the yellow, I could change so, I am still trying to figure out why it didn't run properly.

Tom: It didn’t give you any error message? What’s the error message say?

Mitsuyo: Yeah, it didn’t give me many details.

Tom: It should give you an error report. What if you click the eyeball?

Mitsuyo: The eyeball in the report?

Tom: Maybe this is it, “unable to finish job”…I don’t know, I guess one possibility is, it doesn’t have enough memory.

Mitsuyo: I tried to upload one of the three files and it didn’t run…

From: Mitsuyo <email address>
Date: Friday, April 3, 2020 13:36
To: Rebecca Carlson <email address>
Subject: Re: tomorrow morning!

Sorry for this mistake, and making you wait without feedback.

we already had our meeting.

I should have email you instead. Next time I will email when we are about to start, instead of trying to start a zoom conference.

We will have our meeting on the same time scheduled on wednesday and Fridays

Best Mitsuyo

From: Mitsuyo <email address>
Date: Friday, April 3, 2020 13:33
To: Rebecca Carlson <email address>
Subject: Re: tomorrow morning!

Hi Becca , I tried to start a call/conference on zoom using your link, but I couldn’t see your answer, so we thought you were not around

From: Rebecca Carlson <email address>
Date: Friday, April 3, 2020 12:59
To: Mitsuyo <email address>
Subject: Re: tomorrow morning!

Hi Mitsuyo,

Are you guys meeting today?

Thanks,
Rebecca

On Thu, Apr 2, 2020 at 11:53 PM Mitsuyo <email address> wrote:

Thanks rebecca!

We can try that!

From: Rebecca Carlson <email address>
Date: Thursday, April 2, 2020 23:47
To: Mitsuyo <email address>, Tom <email address>
Subject: Re: tomorrow morning!

Hi Mitsuyo and Tom,

Sorry to email so late (is this just a Japanese phrase, left over from keitai email?).

If it would help, here's a zoom meeting link we can use tomorrow. It shouldn't have any time restrictions on it, fingers crossed.

Thanks,
Rebecca

https://Zoom Domain.zoom.us/j/Meeting ID

On Tue, Mar 31, 2020 at 5:43 PM Mitsuyo <email address> wrote:

Thank you Rebecca!

Snow was so unexpected right?! Oddily beautiful to see some snow among sakura bloom.

I confirm the meeting for tomorrow, see you soon!

Mitsuyo

From: Rebecca Carlson <email address>
Date: Tuesday, March 31, 2020 15:33
To: Mitsuyo <email address>
Subject: Re: tomorrow morning!

Here is a link for tomorrow morning, if I can join your meeting again!

Bte, did you see the snow over the weekend? Crazy!
My daughter even made a snowman, but it's gone now.

See you later,
Rebecca

https://Zoom Domain.zoom.us/j/Meeting ID

On Fri, Mar 27, 2020 at 1:52 PM Rebecca Carlson <email address> wrote:

Thanks again for letting me join your meeting!

It is a fun way to sit in even though I am stuck at home.

Take care this weekend!
Rebecca

On Fri, Mar 27, 2020 at 1:06 PM Mitsuyo <email address> wrote:

Hi Becca, We are ready

Mitsuyo

From: Rebecca Carlson <email address>
Date: Friday, March 27, 2020 11:06
To: Mitsuyo <email address>
Subject: Re: tomorrow morning!

Here's one. Let's try this, whenever you are ready, I will be around.
https://Zoom Domain.zoom.us/j/Meeting ID

On Fri, Mar 27, 2020 at 10:51 AM Rebecca Carlson <email address> wrote:

Really? Cool!, thanks!

I’ll send a zoom link in a bit,

R

On Fri, Mar 27, 2020 at 9:49 Mitsuyo <email address> wrote:

Hi Rebecca,

I will email you or try to call by zoom when we start.

I am so sorry, I forgot to reply yesterday.

See you soon
Mitsuyo

From: Rebecca Carlson <email address>
Date: Thursday, March 26, 2020 16:50
To: Mitsuyo <email address>
Subject: Re: tomorrow morning!

Hi Mitsuyo,

You have a meeting tomorrow with Tom as well? Would you be up for letting me join that too?
If it is a hassle for you guys, then please don't worry about it!

It was nice "seeing" you yesterday!
Rebecca

On Wed, Mar 25, 2020 at 8:44 AM Mitsuyo <email address> wrote:

Hi Becca, Tom is here.

I opened the zoom link but I think I am not allowed to call or start that

Mitsuyo

From: Rebecca Carlson <email address>
Date: Wednesday, March 25, 2020 7:57
To: Mitsuyo <email address>
Subject: Re: tomorrow morning!

Thanks for letting me know! See you later,

On Wed, Mar 25, 2020 at 7:56 AM Mitsuyo <email address> wrote:

Sure Rebecca, I will share the screen with you.

Tom will arrive a little later , so I might call later than usual.

Thanks
Mitsuyo

From: Rebecca Carlson <email address>
Date: Tuesday, March 24, 2020 21:29
To: Mitsuyo <email address>
Subject: Re: tomorrow morning!

Awesome, thank you! I will be lurking around but please don't rush your start time for me. I will have a lot to keep me busy.

Also, if you are willing to "share your screen" with me so I can see your notes and such data, I would be super grateful.

Thanks again,
Rebecca

On Tue, Mar 24, 2020 at 6:33 PM Mitsuyo <email address> wrote:

Hi Rebecca,

thanks for providing a link for tomorrow’s call, I just installed Zoom in my computer.

Although I will use it for the first time, it looks like a user friendly software, so I think it will be ok for the meeting!

See you tomorrow
Mitsuyo

From: Rebecca Carlson <email address>
Date: Tuesday, March 24, 2020 18:16
To: Mitsuyo <email address>
Subject: tomorrow morning!

Hi Mitsuyo,

I meant to email earlier to check in with you but the day got away from me! I hope things are going well for you.

Tom has said it is okay for me to call in to participate virtually with your meeting tomorrow morning. If that works okay for you, I thought the easiest thing to do was start a zoom meeting, which is pretty easy to use.

Here's the link to use, if this sounds okay to you.

Thanks and see you tomorrow morning,
Rebecca

https://Zoom Domain.zoom.us/j/Meeting ID

# This beginning # always starts # back # at the beginning.

Acknowledgements

I want to thank all the lab members who, for over two years, were (part of) this research. They gave their time and attention to me in ways I can only hope to more properly thank them for, some day. I also want to thank Libuše Hannah Vepřek, Sarah Thanner and Tayeba Batool who all read and gave helpful feedback on drafts of this work. At Platypus, special thanks to Katie Ulrich, Managing Editor and especially Angela Kristin VandenBroek, Web Producer, who kindly put this whole thing together for me!

Finally, I am inspired in this activity by Jay Ruby, who was my advisor at Temple, and Rodrick Coover’s work, who was joining Temple’s Film and Media Arts department just as I was leaving. Jeffrey Rush, also at Temple, first taught me about interactive narrative and supported my MFA thesis, an hypertext-fiction titled, The Aviary. It's probably on a decaying CD somewhere in my closet.

This research is supported by the Japan Society for the Promotion of Science’s Grant-in-Aid for Scientific Research (C) 20K01188.

References

Coover, R. (2003). Cultures in webs: Working in hypermedia with the documentary image. CITY: Eastgate Systems.

Deleuze, G. & Guattari, F. (1993) A thousand plateaus. Minnesota: The University of Minnesota Press.

Droney, D. (2014) Ironies of laboratory work during Ghana’s second age of optimism. Cultural Anthropology 29:2, 363-384, https://doi.org/10.14506/ca29.2.10

DeSilvey, C. (2006) Observed decay: Telling stories with mutable things. Journal of Material Culture 11:3, 318–338, https://doi.org/10.1177/1359183506068808

Favero, P. (2014) Learning to look beyond the frame: reflections on the changing meaning of images in the age of digital media practices. Visual Studies 29:2, 166-179, http://dx.doi.org/10.1080/1472586X.2014.887269

Larkin, B. (2008) Signal and noise: Media, infrastructure, and urban culture in Nigeria. Durham: Duke University Press.

Li N., Jin K., Bai Y., Fu H., Liu L. and B. Liu (2020) Tn5 transposase applied in genomics research. Int J Mol Sci. Nov 6;21(21):8329. doi: 10.3390/ijms21218329.

Krasmann, S. (2020) The logic of the surface: on the epistemology of algorithms in times of big data, Information, Communication & Society, 23:14, 2096-2109, https://doi.org/10.1080/1369118X.2020.1726986

McClintock, B. (1973) Letter from Barbara McClintock to maize geneticist Oliver Nelson.

Pink S., Ruckenstein M., Willim R., and M. Duque (2018) Broken data: Conceptualising data in an emerging world, Big Data & Society January–June: 1–13.

Ravindran, S. (2012) Barbara McClintock and the discovery of jumping genes. PNAS 109 (50) 20198-20199, https://doi.org/10.1073/pnas.1219372109

Ruby, J. (2005) Oak Park stories. Watertown: Documentary Educational Resource.

Venables, W. N., Smith D. M. and the R Core Team (2022) An introduction to R. Notes on R: A programming environment for data analysis and graphics, version 4.2.2 (2022-10-31).

Virilio, P. (1997) Open sky. Translated by J. Rose. London: Verso.

Virilio, P. (1999) Politics of the very worst: An interview by Philippe Petit. Edited by S. Lotringer and translated by M. Cavaliere. New York: Semiotext(e).

Virilio, P. (2000) Polar inertia. Translated by P. Camiller. London: Sage

Additional Web Resources

CebolaLab / RNA-seq: A Step-by-Step Analysis Pipeline for RNA-seq Data

EMBL - EBI Training: Single-cell RNA-seq Analysis Using R

National Library of Medicine’s GRCh38, Genome Reference Consortium Human Build 38

Reference Genomes and Genomics File Formats, Rockefeller University, Bioinformatics Resource Centre

R Tutorial - Introduction to RNA-seq, Data Camp

R Tutorial - RNA-seq Workflow, Data Camp

Tutorials Point: R - Basic Syntax

$ R